Appeal No. 94-3279
Application 07/892,598
DECISION ON APPEAL
This is an appeal under 35 U.S.C. § 134 from the final rejection of claims 67
through 70 and 72 through 79, all the claims in the application.
Claims 80, 81, and 82 are illustrative of the subject matter on appeal and read as
follows:
80. A process for using an E. coli comprising an expression plasmid
comprising:
(i) an E. coli trp promoter;
(ii) the nucleotide sequence TAAAAAGGAGAATTC encoding a ribosome
binding site for translation of element (iii); and
(iii) a structural gene coding the amino acid sequence of a heterologous
protein,
to produce said heterologous protein, which process comprises cultivating said E. coli
comprising said expression plasmid in an aqueous medium comprising an assimilable
source of carbon, nitrogen and inorganic salts.
81. A process for using an E. coli comprising an expression plasmid
comprising:
(i) an E. coli trp promoter;
(ii) the nucleotide sequence TAAAAAGGGTATCGAGAATTC encoding a
ribosome binding site for translation of element (iii); and
(iii) a structural gene coding the amino acid sequence of a heterologous
protein,
to produce said heterologous protein, which process comprises cultivating said E. coli
comprising said expression plasmid in an aqueous medium comprising an assimilable
source of carbon, nitrogen and inorganic salts.
82. A process for using a microorganism selected from the group consisting of
E. coli K-12 strains comprising plasmid pPFZ-R2 and E. coli strains comprising plasmid
pPFZ-R4 to produce prorennin, which process comprises cultivating said microorganism
in an aqueous nutrient medium comprising an assimilable source of carbon, nitrogen and
2
Page: Previous 1 2 3 4 Next
Last modified: November 3, 2007