Ex parte FRANKE - Page 2




                   Appeal No. 94-3279                                                                                                                               
                   Application 07/892,598                                                                                                                           




                                                                DECISION ON APPEAL                                                                                  
                            This is an appeal under 35 U.S.C.  134 from the final rejection of claims 67                                                           
                   through 70 and 72 through 79, all the claims in the application.                                                                                 
                            Claims 80, 81, and 82 are illustrative of the subject matter on appeal and read as                                                      
                   follows:                                                                                                                                         
                            80.       A process for using an E. coli comprising an expression plasmid                                                               
                   comprising:                                                                                                                                      
                            (i)       an E. coli trp promoter;                                                                                                      
                            (ii)      the nucleotide sequence TAAAAAGGAGAATTC encoding a ribosome                                                                   
                                      binding site for translation of element (iii); and                                                                            
                            (iii)     a structural gene coding the amino acid sequence of a heterologous                                                            
                            protein,                                                                                                                                
                   to produce said heterologous protein, which process comprises cultivating said E. coli                                                           
                   comprising said expression plasmid in an aqueous medium comprising an assimilable                                                                
                   source of carbon, nitrogen and inorganic salts.                                                                                                  
                            81.       A process for using an E. coli comprising an expression plasmid                                                               
                   comprising:                                                                                                                                      
                            (i)       an E. coli trp promoter;                                                                                                      
                            (ii)      the nucleotide sequence TAAAAAGGGTATCGAGAATTC encoding a                                                                      
                                      ribosome binding site for translation of element (iii); and                                                                   
                            (iii)     a structural gene coding the amino acid sequence of a heterologous                                                            
                            protein,                                                                                                                                
                   to produce said heterologous protein, which process comprises cultivating said E. coli                                                           
                   comprising said expression plasmid in an aqueous medium comprising an assimilable                                                                
                   source of carbon, nitrogen and inorganic salts.                                                                                                  
                            82.       A process for using a microorganism selected from the group consisting of                                                     
                   E. coli K-12 strains comprising plasmid pPFZ-R2 and E. coli strains comprising plasmid                                                           
                   pPFZ-R4 to produce prorennin, which process comprises cultivating said microorganism                                                             
                   in an aqueous nutrient medium comprising an assimilable source of carbon, nitrogen and                                                           

                                                                                 2                                                                                  





Page:  Previous  1  2  3  4  Next 

Last modified: November 3, 2007