Interference 102,728
b. SX 3 Bates No. 126
SX 3, Bates No. 126 is a page which is said to be from Dr. Singh’s notebook. As
an initial matter, we point out that the evidence before us is only a photocopy of what is
said to be the original notebook page.35 The page includes a “Synthetic DNA Request”
for an oligonucleotide which is a 24-mer (“5' AGGGAGATCACATCTTTTATCCAA”).
The requestor is listed as Arjun Singh. The order has been approved by Mark P.
Vasser, and dated “12-1-82.” According to Brake, and Singh does not disagree, the
Synthetic DNA Request form shown on the page has been taped into the notebook.
In the upper left corner of the notebook page is an undated, handwritten
notation which reads “oligonucleotide for making in-frame deletion of "pro-IFN-D
junction.” At the bottom of the page is a handwritten date “12/21/82" recorded by
Dr. Singh. The witnessing was done three and one half years later; i.e., “6/13/86.”
Singh urges that because the 24-mer shown on the laboratory notebook page
dated “12/21/82” (SX 3, Bates No. 126) is complementary to the four (4) codons on
each side of the glu-ala sequence indicated on the laboratory notebook page dated
“11/24/82” (SX 3, Bates No. 108) that Dr. Singh conceived of the “loop deletion”
mutagenesis technique for removing the glu-ala sequence of the " factor spacer
35 We note Brake’s belated submission of three (3) declarations; i.e., the
declarations of Ms. Debra A. Shetka (Paper No. 187), Dr. Catherine M. Polizza (Paper
No. 188) and Dr. Michael R. Ward (Paper No. 189), which discuss the different colors of
ink present on Dr. Singh’s laboratory notebook page, SX 3, Bates No. 126. See also,
Brake Brief, Paper No. 190, pp. 70-71. We point out that the filing of these declarations
is improper. To enter new evidence at this point, Brake’s only recourse is to file a
motion to reopen testimony. 37 C.F.R. § 1.687. This Brake did not do and, thus, the
declarations have not been considered by this merits panel.
58
Page: Previous 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 Next
Last modified: November 3, 2007